Праймер 1: Праймер битумный ТЕХНОНИКОЛЬ №01 20 л

Содержание

Праймер битумный №01 20 л (16 кг)

ОСОБЕННОСТИ

-готов к применению
-обладает высокой проникающей способностью
-применяетсяпри отрицательных температурах
-быстросохнущий

Назначение:

-подготовка (огрунтовка) оснований перед укладкой наплавляемых, самоклеящихся кровельных и гидроизоляционных материалов. Праймирование необходимо для обеспечения прочного сцепления гидроизоляционных материалов с пористыми, шероховатыми и пыльными поверхностями

Описание:

Представляет собой раствор высококачественных нефтяных битумов с температурой размягчения не ниже 80°С
в специально подобранных органических растворителях. Обладает высокой смачивающей, проникающей способностью и малым временем высыхания. Готовый праймер сразу наносится на основание, что дает дополнительное удобство и повышает скорость выполнения работ.

Способ применения:

Рекомендуется наносить на обрабатываемую поверхность щетками или кистями.


При таком нанесении праймер втирается в поверхность, насыщает и скрепляет ее, обеспечивая прочное сцепление гидроизоляционного покрытия с основанием.

Расход праймера — 0,25–0,35 л/м2 (1 л праймера на 3,33 м2 поверхности).

Хранение:

Хранить в сухом, защищенном от света месте при температуре
от -20°C до +30°C. Гарантийный срок хранения — 12 месяцев.

Таблица Характеристик материалов
Наименование показателя Ед. измерения Значение Метод испытаний
Массовая доля нелетучих веществ, в пределах % 45-55 По ГОСТ Р 52487 (ИСО 3251:2003)
Время высыхания, не более ч 12 ГОСТ 19007-73
Условная вязкость, в пределах с 15-40 По ГОСТ 8420 на вискозиметре ВЗ-246 по ГОСТ 9070, с диаметром сопла 4 мм.

 

Праймер битумный Технониколь № 01

Праймирование – надежная гидроизоляция конструкции

Кровля здания является одним из важных этапов строительства. Гидроизоляцию проводят очень тщательно, подбирая специальное покрытие, максимально защищающее от атмосферных явлений. Сцепление кровли с гидроизоляционными материалами при этом должно быть идеальным, для чего требуется подготовка при изоляционных работах – грунтовка кровли битумным праймером (праймирование).

Данный строительный материал является смесью водной эмульсии смолоподобных продуктов и горючей жидкости. Он имеет черный окрас, жидкую консистенцию, обладает идеальными водоотталкивающими свойствами. Стройматериалы для праймирования, которые предлагает современный рынок, бывают готового типа и требующие разведения. Первые нет необходимости разводить перед гидроизоляционными работами оснований зданий, фундаментов, подземных конструкций, мостовых пролетов, металлических трубопроводов. Состав также идеально защищает металлические конструкции от коррозии, в результате воздействия влаги.

Стройматериал Технониколь – номер один в строительстве

Данная грунтовка применяется для разных типов поверхностей из бетона, цемента, цементно-песчаных типов, металла, железобетона и других вариантов. Праймирование мягкими губками гарантирует лучшую пропитку и идеальное сцепление с гидроизоляционными материалами.

Большое разнообразие строительных материалов по приемлемой цене предлагает современный рынок, среди которых самым популярным в Украине является кровельный битумный праймер Технониколь № 1 (no1). Это полностью готовый состав, который не требует дополнительного разведения перед нанесением на различную поверхность кровель и других сооружений, от чего зависит расход (в среднем он составляет 250-350 грамм на м2). Данная грунтовка обладает рядом преимуществ:

  • простое пользование, не требующее особых навыков;
  • высокие гидроизоляционные качества;
  • хорошая адгезия с гидроизоляционными материалами;
  • быстрое высыхание до 12 часов с отсутствием липкости;
  • экологически безопасный состав.

Подготовительные работы возможно производить летом и зимой. Они значительно продлят срок эксплуатации кровельного гидроизоляционного материала и снизит временные и финансовые затраты при последующих ремонтах. Стоимость битумного праймера Технониколь № 01 (no01), который имеется в интернет-магазине «Будива», зависит от объема тары грунтовки (цена за 10л, 20л, 50л указана на сайте).

Удобное приобретение стройматериалов из дома в компании «Будива»

Мы являемся дилером корпорации Sweetondale, поэтому в интернет-магазине «Будива» вы можете, не выходя из дома купить праймер Технониколь 01, теплоизоляционные плиты PIR, также в каталоге имеется битумная мастика и другие стройматериалы по цене от производителя. Мы предлагаем выгодные условия сотрудничества, быструю обработку заявок, широкий ассортимент товаров, приятные акционные сюрпризы, которые помогут существенно экономить при покупках. После оформления заказа праймер Технониколь номер 1 и прочие материалы будут доставлены в кратчайшие сроки в любой город, благодаря идеально налаженной системы логистики нашей компании.

Если возникают вопросы, в любой момент можно воспользоваться консультациями наших менеджеров. Специалисты «Будива» помогут с выбором стройматериалов, а также произведут расчет количества материалов, согласно предназначению.

Мы работаем для обеспечения необходимыми товарами для выполнения качественного строительства и экономии времени клиентов!

Siberia Праймер-1 универсальный адгезионный грунт

Описание

Отлично подходит для подготовки к покраске сложных поверхностей, таких как стекло, винил, пластик, ламинат, кафельная плитка, порошковые покрытия и т.д.

Применение:
Для бытового, коммерческого и промышленного использования внутри и снаружи помещений на поверхностях, предназначенных для последующего нанесения на них водно-дисперсионных, алкидных, полиуретановых красок и эмалей.

Характеристики:
Образует белое шелковисто-матовое покрытие, быстро высыхает, легко шлифуется, имеет высокую адгезию к различным материалам, препятствует росту плесени,

ингибирует коррозию.

Подготовка поверхности:
обрабатываемая поверхность должна быть сухой и чистой. Глянцевые поверхности перед нанесением грунта слегка обработать наждачной бумагой мелкой
зернистости, удалить пыль.

Нанесение:
Перед применение тщательно перемешать состав. Нанесение производить валиком с коротким ворсом, кистью, воздушным или безвоздушным распылением, методом
Airmix.

Реставрация школьной доски:


1 Зашкурить основание наждачной бумагой мелкой зернистости, удалить пыль влажной тряпкой, высушить.
2 Нанести грунт Siberia Primer-1 в два слоя с интервалом 1 час, оставить высыхать еще на 1 час.
3 Нанести грифельную краску Siberia в два слоя.

Покраска сложных поверхностей — пластик, винил, стекло, керамика, ЛДСП.
1 Подготовить основание для нанесения — вымыть и обезжирить поверхность при необходимости.
2 Нанести грунт Siberia Primer-1 в два слоя с интервалом 1 час, оставить высыхать еще на 1 час.
3 Нанести финишную краску.

Грунт имеет выраженный, не резкий запах, который быстро выветривается.

Грунт нетоксичен, пожаровзрывобезопасен. При наружном контакте с глазами или слизистой оболочкой может вызывать раздражение.

При случайном попадании промыть большим количеством воды.

Инструмент отмывать теплой водой непосредственно после применения, не допуская высыхания.

Транспортировка и хранение:
при температуре от +5°С до +30°С в плотно закрытой таре.

Внимание!
Данный грунт не предназначен для применения в качестве антикоррозионного покрытия!

Грунтовки — праймеры ПЛИТОНИТ Грунт 1

Ленинградская область

Санкт-Петербург

Бокситогорск

Васкелово

Волосово

Волхов

Всеволожск

Выборг

Выра

Вырица

Гатчина

Грузино

Дранишники

Заполье

Зеленогорск

Кингисепп

Кириши

Кировск

Колпино

Колтуши

Коммунар

Лодейное поле

Ломоносов

Лосево

Луга

Мичуринское

Мурино

Ново-Токсово

Отрадное

Павлово

Песочный

Пикалево

Приозерск

Псков

Романовка

Ропша

Рощино

Сестрорецк

Сиверский

Сланцы

Сосново

Сосновый Бор

Тихвин

Токсово

Тосно

Ульяновка

Черемыкино

Москва и Московская область

Алтуфьево

Видное

Владимир

Дмитров

Дубино

Дубна

Егорьевск

Зеленоград

Иваново

Истра

Климовск

Клин

Коломна

Кострома

Красногорск

Кубинка

Лосино-Петровский

Люберцы

Меличкино

Можайск

Мытищи

Ногинск

Одинцово

Орехово-Зуево

п.

Соболиха

Павловский Посад

пгт. Белоозерский

Подольск

Пушкино

Раменское

Сергиев Посад

Серпухов

Сокольники

Старая Купавна

Тарасовка

Химки

Хотьково

Шолохово

Шуя

Щелково

Электросталь

Юдино

Ям

Ярославль

Алтайский край

Барнаул

Амурская область

Благовещенск

Архангельская область

Архангельск

Новодвинск

Северодвинск

Брянская область

Брянск

Волгоградская область

Волгоград

Волжский

Вологодская область

Белозерск

Великий Устюг

Вологда

Воронеж

п. Кадуй

п. Шексна

Тотьма

Череповец

Воронежская область

Воронеж

Забайкальский край

Чита

Ивановская область

Иваново

Шуя

Иркутская область

Ангарск

Иркутск

Шелехов

Кабардино-Балкаарская Республика

Баксан

Нальчик

Калининградская область

Калининград

Калужская область

Кемеровская область

Кемерово

Новокузнецк

Кировская область

Киров

Кирово-Чепецк

Костромская область

Кострома

Краснодарский край

Адлер

Адыгея

Краснодар

Курганинск

Сочи

Красноярский край

Красноярск

Курганская область

Курган

Шадринск

Курская область

Курск

Мурманская область

Апатиты

Кандалакша

Мурманск

Нижегородская область

Нижний Новгород

Новгородская область

Боровичи

Великий Новгород

Старая Русса

Новосибирская область

Новосибирск

Омская область

Омск

Оренбургская область

Бузулук

Новотроицк

Оренбург

Орск

Пензенская область

Пенза

Пермский край

Пермь

Приморский край

Артем

Владивосток

Находка

Псковская область

Великие Луки

Псков

Республика Башкортостан

Бирск

Красноусольский

Кумертау

Нефтекамск

Октябрьский

Салават

Стерлитамак

Уфа

Республика Беларусь

Минск

Республика Бурятия

Улан-Удэ

Республика Дагестан

Махачкала

Республика Казахстан

Астана

Республика Карелия

Костомукша

Петрозаводск

Сегежа

Сортавала

Республика Коми

Сыктывкар

Республика Крым

Севастополь

Симферополь

Республика Мордовия

Саранск

Республика Татарстан

Казань

Набережные Челны

Республика Чувашия

Чебоксары

Ростовская область

Аксай

Батайск

г. Каменск-Шахтинский

Новочеркасск

Ростов-на-Дону

Рязанская область

Рязань

Самарская область

Кинель

п. Волжский (Царевщина)

п. Стройкерамика

Похвистнево

Самара

Тольятти

Ульяновск

Саратовская область

Саратов

Сахалинская область

Южно-Сахалинск

Свердловская область

Екатеринбург

Нижний Тагил

Ставропольский край

Михайловск

Невинномысск

Ставрополь

Тверская область

Тверь

Тульская область

Тула

Тюменская область

Тобольск

Тюмень

Ялуторовск

Ульяновская область

Ульяновск

Хабаровский край

Хабаровск

Ханты-Мансийский АО (Югра)

Сургут

Челябинская область

Челябинск

Читинская область

Чита

Ярославская область

Ярославль

Ушные бирки и татуировки с изображением домашнего скота

Ваш браузер отключил или блокирует Javascript.

Если вы используете блокировщик контента, убедитесь, что вы не отключили глобально Javascript.

Если вы отключили его вручную в своем браузере, включите его, чтобы улучшить работу с этим сайтом.

Бирки для ушей являются важным инструментом в животноводстве .Их можно использовать в качестве наглядного пособия для определения пола, года рождения, отца, матери и многого другого. Мы также можем предоставить ушные бирки, соответствующие требованиям Программы по искоренению скрепи Министерства сельского хозяйства США для овец и коз. Premier предлагает БЕСПЛАТНО индивидуальной печати, и бирки будут доставлены прямо к вашей двери!
для овец и коз
Производители обязаны соблюдать федеральные и государственные правила для официальной идентификации своих овец и коз. Premier 1 предлагает одобренных USDA меток в нескольких стилях. БЕСПЛАТНАЯ ДОСТАВКА ПРИ КВАЛИФИЦИРОВАННЫХ ЗАКАЗАХ НА СУММУ СВЫШЕ 100 $!

Почему людям нравятся наши ушные бирки…

  1. Низкие цены
    Для некоторых размеров наши бирки стоят вдвое дешевле, чем другие марки. Как мы можем это сделать? Большинство продаж меток происходит в наши более медленные зимние месяцы, поэтому мы предпочитаем продавать как можно больше меток, чтобы наши сотрудники были заняты. Это «победа» и для вас, и для нас.
  2. Индивидуально для вас…
    Наши индивидуальные бирки с лазерной печатью с вашим выбором последовательных номеров и номера / имени помещения стоят по той же цене, что и пустые бирки.Мы также печатаем ярлыки с брендами или логотипами (единовременная плата за установку 25 долларов за дизайн) , а также ярлыки с индивидуальными именами или номерами.
  3. Очень быстрое обслуживание — вот кто мы!
    Большинство наших заказов на бирки, включая те, которые отпечатаны специально для вас, обычно отправляются в течение 2–3 рабочих дней с момента получения заказа.

Электрический забор — Premier1Supplies

Ваш браузер отключил или блокирует Javascript.

Если вы используете блокировщик контента, убедитесь, что вы не отключили глобально Javascript.

Если вы отключили его вручную в своем браузере, включите его, чтобы улучшить работу с этим сайтом.

Выберите лучший дизайн забора для вашего участка

Позвольте Premier помочь решить, какой забор лучше всего подходит для вашей ситуации.Выберите животное ниже, которое будет использоваться забором, чтобы держать его внутри или снаружи.


При правильном планировании установка собственных заборов не должна пугать. Премьер имеет многолетний опыт установки и использования электрических и неэлектрических ограждений на собственных фермах. Чтобы помочь вам начать работу, мы собрали ответы на несколько распространенных вопросов по фехтованию . БЕСПЛАТНАЯ ДОСТАВКА ПРИ КВАЛИФИЦИРОВАННЫХ ЗАКАЗАХ НА СУММУ СВЫШЕ 100 $!

Для более безопасных электрических ограждений:

  • Сделайте заборы видимыми для людей и животных. Контрастность усиливает видимость (поэтому многие цепи и проводники Premier имеют черный и белый цвет).
  • Обучайте, обучайте, обучайте. Повесьте предупреждающие знаки на всех электрических ограждениях. Скажите детям, чтобы они никогда не трогали его. Всем следует избегать контакта головы и шеи.
  • Оставьте место для людей и животных , чтобы они могли легко ходить по нему или вокруг него.
  • ЗАПРЕЩАЕТСЯ использовать зарядное устройство для заборов с маркировкой «высокоомный, непрерывный ток, устройство для сжигания сорняков или измельчитель сорняков» на электропластиковых ограждениях. (Эти устройства могут расплавить пластик!) Если вы не уверены, обратитесь к специалисту по ограждению . Специалисты Premier имеют многолетний опыт и могут помочь. Позвоните нам по бесплатному телефону: 800-282-6631.

Подробнее

KILZ® Стандартная грунтовка для внутренних работ | KILZ®

KILZ® 1 СТАНДАРТ Внутренняя грунтовка оценена 4,7 из 5 автор: 56.

Оценка 5 из 5 к Не Карен из Уплотнения в запахах Арендатор держал неразрешенных домашних животных и оставил ужасный запах. Я вырвал ковер и покрасил деревянные полы, чтобы устранить оставшийся запах. Это сделало свою работу.

Дата публикации: 2021-10-11

Оценка 5 из 5 к Ron48 из Скрывает старую краску Я много лет использую Kilz, пытаясь скрыть стены темного цвета, чтобы осветлить комнату.

Дата публикации: 2021-10-05

Оценка 5 из 5 к Meh00 из Отличное покрытие Обеспечивает отличное герметизирующее покрытие на всех поверхностях, позволяя лучше покрыть любую краску за меньшее количество слоев.Предупреждение, ваши цвета появятся и покажут свой истинный цвет, поэтому, если вы хотите, чтобы цвета отображались жирным, используйте Kilz

Дата публикации: 2021-10-05

Оценка 5 из 5 к СтивенДжерри из Работает! Стены и потолок спальни дочерей покрыты картинами, окрашенными аэрозольной краской. KILZ® 1 STANDARD Интерьерная грунтовка полностью покрыта и загрунтована для перекраски.

Дата публикации: 2021-08-28

Подготовка поверхности *

Следующие шаги рекомендуются для повышения производительности продукта.

  • Все поверхности должны быть чистыми, очищенными от пыли, мела, масла, жира, воска, полироли, плесени и плесени, отслаивающейся краски, ржавчины и других посторонних веществ.
  • Если необходима стирка, используйте немыльное моющее средство или заменитель TSP, хорошо промойте и дайте высохнуть.
  • Отслаивающаяся или проверенная краска: Соскребите отслоившуюся краску и отшлифуйте до гладкой поверхности. Шлифовка или удаление краски, содержащей свинец, опасно. *
  • Глянцевые поверхности: Грунтовки KILZ PREMIUM и KILZ 2® рекомендуются для использования на должным образом подготовленных глянцевых поверхностях.
  • Поверхности, покрытые плесенью или плесенью: промойте участок средством для удаления плесени, промойте водой и дайте высохнуть перед нанесением грунтовки. Примечание. Грунтовки KILZ PREMIUM, KILZ 2 и KILZ для кухни и ванны рекомендуются для поверхностей, подверженных образованию плесени.
  • Кладка, кирпич, штукатурка и штукатурка: Грунтовка KILZ STANDARD может использоваться на чистых, сухих, состаренных поверхностях кладки. Перед нанесением грунтовки KILZ STANDARD Primer новой кладке необходимо дать высохнуть не менее чем за 30 дней.

Приложение

  • Рекомендуется защита глаз.Для распыления можно добавить небольшое количество воды (не более ½ пинты на галлон).
  • Применяется только в том случае, если температура поверхности, воздуха и продукта составляет 10–32 ° C (50–90 ° F). Тщательно перемешивайте перед использованием и время от времени во время использования.
  • Нанести кистью, валиком или распылителем.
  • Кисть — высококачественный нейлон / полиэстер
  • Валик — Высококачественный ворс 3/8-1 / 2 дюйма на гладких поверхностях или ворс 1 / 2-3 / 4 дюйма на полушероховатых или пористых поверхностях.
  • Безвоздушное распыление -.017-.021 наконечник / фильтр 60 меш
  • Загрунтуйте всю поверхность, чтобы обеспечить равномерный внешний вид финишного покрытия.
  • Блокирование пятен: Важно — Для блокирования пятен используйте грунтовки на масляной основе, такие как KILZ ORIGINAL, или грунтовки на водной основе, такие как KILZ PREMIUM.
  • Колеровка: KILZ STANDARD Primer можно тонировать с использованием до 2 унций универсального красителя на галлон. Рекомендуется подкрашивать до более светлого оттенка, чем финишное покрытие.
  • Покрытие: 300-400 кв. Футов (28-37 м 2 ) на галлон в зависимости от метода нанесения и пористости поверхности.

Время высыхания при 77 ° F (25 ° C), относительной влажности 50%

  • Высыхает на ощупь за 30 минут.

  • Можно перекрыть или перекрыть за один час латексной или масляной краской.

  • Низкие температуры, высокая влажность или плохая вентиляция могут значительно увеличить время высыхания и нанесения краски.

Очистка и утилизация

  • Очистите оборудование и брызги краски теплой мыльной водой. В случае разлива соберите материал и удалите инертным абсорбентом. Утилизируйте загрязненный абсорбент, контейнер и неиспользованный продукт в соответствии со всеми действующими федеральными, государственными и местными правилами.
  • Не выбрасывайте этот продукт в канализацию. Пожалуйста, рассмотрите возможность пожертвовать любой неиспользованный продукт. Для получения информации о переработке или утилизации обратитесь в местную службу вывоза бытового мусора.

ПОЖИЗНЕННАЯ ОГРАНИЧЕННАЯ ГАРАНТИЯ

Masterchem Industries LLC гарантирует вам, первоначальному покупателю-потребителю, работоспособность этого продукта, как описано на этой этикетке, до тех пор, пока вы проживаете в своем доме.Если в результате проверки представителем этого продукта будет обнаружен дефект, Masterchem Industries LLC по своему усмотрению и при предъявлении доказательства покупки (оригинала квитанции) либо предоставит эквивалентное количество нового продукта, либо возместит первоначальную покупку. цена этого продукта вам. Данная гарантия не подлежит передаче. Эта гарантия не включает (1) труд и затраты на рабочую силу для установки или удаления любого продукта и (2) любые побочные или косвенные убытки, вызванные нарушением явной или подразумеваемой гарантии, небрежностью, строгой ответственностью или любой другой юридической теорией.В некоторых штатах не допускается исключение или ограничение случайных или косвенных убытков, поэтому вышеуказанное ограничение или исключение может не относиться к вам. В той степени, в которой это разрешено применимым законодательством, любые подразумеваемые гарантии, включая подразумеваемые гарантии товарной пригодности и пригодности для определенной цели, ограничиваются сроком действия данной прямой гарантии. В некоторых штатах не допускается ограничение срока действия подразумеваемой гарантии, поэтому указанное выше ограничение может не относиться к вам. Эта гарантия дает вам определенные юридические права, и вы также можете иметь другие права, которые варьируются от штата к штату. Примечание для жителей штата Нью-Джерси: положения данной гарантии, включая ее ограничения, предназначены для применения в максимальной степени, разрешенной законами штата Нью-Джерси. Для гарантийного обслуживания звоните: 1-866-774-6371 или по электронной почте: techser[email protected] Masterchem Industries LLC оставляет за собой право проверять любое применение продукта до обработки вашей претензии, сделанной в соответствии с данной гарантией.

Предупреждение!

Этот продукт содержит химические вещества, которые, как известно в штате Калифорния, вызывают рак, врожденные дефекты или другие нарушения репродуктивной системы.

ИСПОЛЬЗУЙТЕ ТОЛЬКО С ДОПОЛНИТЕЛЬНОЙ ВЕНТИЛЯЦИЕЙ

Предупреждение! Раздражает!

ВРЕДНО ИЛИ СМЕРТЕЛЬНО ПРИ ПРОГЛАТЫВАНИИ. СОДЕРЖИТ ЭТИЛЕНГЛИКОЛЬ. Избегать контакта с глазами. Может вызвать раздражение глаз, носа и горла. Избегайте вдыхания пыли, паров или аэрозольного тумана. Откройте окна и двери или используйте другие средства для обеспечения доступа свежего воздуха во время нанесения и высыхания. Если вы испытываете слезотечение, головную боль или головокружение, или если мониторинг воздуха показывает, что уровни пара / тумана превышают применимые пределы, наденьте соответствующий, правильно подогнанный респиратор (NIOSH / MSHA TC 23C или аналогичный) во время и после нанесения.Следуйте инструкциям производителя респиратора по использованию респиратора. Закройте контейнер после каждого использования. Тщательно вымыть после работы, а также перед курением и едой.

Предупреждение!

Если поскрести, отшлифовать или удалить старую краску, может образоваться свинцовая пыль. Свинец Ядовит. ВОЗДЕЙСТВИЕ СВИНЦОВОЙ ПЫЛИ МОЖЕТ ПРИВЕСТИ К СЕРЬЕЗНЫМ ЗАБОЛЕВАНИЯМ, ТАКИМ КАК ПОВРЕЖДЕНИЕ МОЗГА, ОСОБЕННО У ДЕТЕЙ. БЕРЕМЕННЫМ ЖЕНЩИНАМ ТАКЖЕ СЛЕДУЕТ ИЗБЕГАТЬ ВОЗДЕЙСТВИЯ. Используйте респиратор, одобренный NIOSH, чтобы контролировать воздействие свинца. Тщательно очистите пылесосом HEPA и влажной шваброй. Перед тем, как начать, узнайте, как защитить себя и свою семью, позвонив на национальную горячую линию информации для руководителей по телефону 1-800-424-LEAD или войдите на сайт www.epa.gov/lead.

Первая помощь

При проглатывании не вызывать рвоту. Немедленно обратитесь за медицинской помощью. Если вы испытываете затрудненное дыхание, выйдите из помещения, чтобы подышать свежим воздухом. Если трудности не исчезнут, немедленно обратитесь за медицинской помощью. В случае попадания в глаза немедленно промойте глаза большим количеством воды в течение не менее 15 минут и обратитесь за медицинской помощью.

БЕЗ ЗАМЕРЗАНИЯ. Если заморожен, дайте ему разморозиться при комнатной температуре.

ХРАНИТЬ В НЕДОСТУПНОМ ДЛЯ ДЕТЕЙ!

Latin Primer 1 — Logos Press

Более половины английского языка происходит от латыни.

аквариум — вода, вода
басня — фабула, рассказ
шум — кламо, я кричать
дельфин — дельфин, дельфин
рассказчик — нарро, я говорю

Когда мы изучаем латынь, мы не просто…

Подробнее

Более половины английского языка происходит от латыни.

аквариум — вода, вода
басня — фабула, рассказ
шум — кламо, я кричать
дельфин — дельфин, дельфин
рассказчик — нарро, я говорю

Когда мы изучаем латынь, мы узнаем не только о Риме, но и о самих себе. Откройте для себя заново этот освященный веками язык, который побудил пионера классического образования Дороти Сэйерс заявила, что «латынь следует начинать как можно раньше… когда пение амо, амас, аматис столь же ритуально приятный для чувств, как пение eeny, meeny, miney, moe ».

В Латинский букварь 1 Марта Уилсон дает ученикам начальной школы (от 3-х классов и выше) прочный фундамент классической латыни. Недавно отредактированный и расширенный, этот текст охватывает самые основы: словарь для повседневных понятий, таких как сельское хозяйство, парусный спорт, человеческое тело, созвездия и семья; окончания глаголов и существительных; и другие понятия начальной грамматики.

Этот пакет является полным Латинский букварь 1 (3-е издание). Это все, что вам нужно, чтобы выучить (или преподать) латынь, начиная с латыни.

Обратите внимание: мы удалили флэш-карты из пакета домашнего обучения, потому что они доступны для бесплатной загрузки. здесь а также здесь . Если вы все же хотите приобрести у нас флэш-карты, перейдите здесь .

Этот пакет содержит следующие предметы:

  • Текст студента (идеальный переплет, 180 страниц)
  • Издание для учителя (идеальная граница)
  • Аудио гид (загрузка аудио) — это аудиогид для загрузки представляет собой один аудиофайл в формате mpeg-4, что означает, что он очень большой.Вы можете перемещаться по файлу в iTunes, щелкнув вкладку «Главы» в строке меню. Это позволяет вам переходить от недели к неделе, а не просто перезапускать файл с самого начала при каждом воспроизведении.

Primer-BLAST: инструмент для разработки целевых праймеров для полимеразной цепной реакции | BMC Bioinformatics

Пользовательский интерфейс

Интерфейс состоит из нескольких разделов, где пользователи могут вводить шаблон ПЦР и / или уже существующие праймеры, а также другие настраиваемые пользователем параметры (рис. 1).

Рисунок 1

Веб-интерфейс Primer-BLAST.

Пользователи могут создавать новые пары праймеров, вводя только матрицу ДНК, или они могут создавать один праймер, вводя матрицу плюс другой уже существующий праймер. Primer-BLAST может проверить специфичность уже существующих праймеров с матрицей или без нее. Матрица ПЦР может представлять собой необработанную последовательность ДНК в формате FASTA или регистрацию NCBI. Если возможно, рекомендуется использовать регистр RefSeq, поскольку он несет больше информации о последовательности [15], что позволяет Primer-BLAST лучше идентифицировать матрицу и, таким образом, лучше проверять специфичность праймера.Primer-BLAST также выполняет быструю проверку любой исходной входной последовательности, чтобы определить, является ли она точным совпадением с последовательностью RefSeq, и в этом случае Primer-BLAST будет использовать доступ RefSeq в качестве шаблона. Длина шаблона ограничена 50 000 базами. Для более длинных шаблонов следует использовать диапазон праймера (верхний правый угол рисунка 1), чтобы ограничить длину.

Primer-BLAST также предлагает возможность конструировать праймеры на основе структуры экзона / интрона, чтобы амплификация ПЦР могла быть лучше нацелена на мРНК.Пользователи могут указать, должен ли праймер охватывать соединение экзон / экзон с регулируемым количеством оснований на каждой стороне соединения и должна ли пара праймеров охватывать интрон вместе с возможностью указания размера интрона. Поскольку этот параметр зависит от точной аннотации границ экзона / экзона, требуется присоединение RefSeq (в качестве шаблона ПЦР), поскольку RefSeq представляет собой категорию лучше всего курируемых последовательностей в NCBI.

Доступно несколько вариантов баз данных для проверки специфичности с широким охватом организмов.Они включают базу данных мРНК RefSeq и базу данных генома RefSeq, которые по состоянию на 18 ноября 2011 г. содержат 226 и 7 546 организмов соответственно. Эти базы данных не являются избыточными, так как они не содержат одни и те же участки последовательности более одного раза, что позволяет лучше проверять специфичность. Они являются предпочтительными базами данных для разработки новых специфичных для мишени праймеров. Традиционная база данных nr, содержащая повторяющиеся записи, также доступна и в основном рекомендуется для организмов, которые не охвачены другими базами данных, или для записей последовательностей, не охваченных базами данных RefSeq.

Primer-BLAST предлагает гибкие варианты жесткости специфичности. Пользователи могут указать количество несовпадений, которые пара праймеров должна иметь с непреднамеренными мишенями, а также 3’-концевую область, где эти несовпадения должны присутствовать. Кроме того, пользователи могут указать порог рассогласования, выше которого любые цели должны игнорироваться (т. Е. Отфильтровывать цели, имеющие слишком много несовпадений, чтобы беспокоиться о неспецифическом усилении). Настройки специфичности по умолчанию таковы, что по крайней мере один праймер (для данной пары праймеров) должен иметь два или более несовпадения с непреднамеренными целями в последних пяти основаниях на 3 ‘конце, и что любые цели с шестью или более несовпадениями по крайней мере с одним праймер (для данной пары праймеров) следует игнорировать.

Не всегда возможно сгенерировать праймеры, специфичные для мРНК конкретного варианта сплайсинга, когда различие в экзонах недостаточно, чтобы отличить один от остальных. Таким образом, Primer-BLAST предлагает вариант обработки вариантов сплайсинга, который позволяет амплифицировать другие варианты того же гена.

Другие параметры, включая параметры чувствительности поиска BLAST, исключения SNP, свойств праймера и т. Д., Можно найти в разделе «Дополнительные параметры».

Представление результатов

Страница результатов сообщает о специфичности сгенерированных праймеров, графическом обзоре пар праймеров по отношению к матрице ПЦР и некоторых характеристиках, таких как экзоны, а также подробную информацию о каждой паре праймеров.Он покажет только специфичные для мишени праймеры, если они будут обнаружены; в противном случае он сообщит обо всех праймерах. Во всех случаях будут перечислены фактические цели вместе с подробным выравниванием праймеров и мишеней.

В качестве примера, иллюстрирующего функциональность Primer-BLAST, мы конструируем праймеры с использованием мРНК варианта 5 транскрипта человеческого цинкового пальца 419 (ZNF419) (номер доступа в Genbank NM_001098494). Как показано на рисунке 2, согласно отчету NCBI Gene, существует семь вариантов транскрипта для гена ZNF419.При поиске использовались значения по умолчанию, которые требуют, чтобы по крайней мере один праймер (для данной пары праймеров) имел два или более несовпадения с непреднамеренными целями в последних пяти основаниях на 3 ’конце. Проверка специфичности проводилась по базе данных мРНК NCBI RefSeq с организмом, ограниченным человеческим организмом, поскольку цель состояла в том, чтобы найти пары праймеров, которые специфичны для этого транскрипта только среди человеческого транскриптома. Чтобы избежать возможной амплификации геномной ДНК, выбран вариант «Праймер должен охватывать соединение экзон-экзон».Как показано на рисунке 3, Primer-BLAST успешно вернул пять специфических пар праймеров, и показано детальное сопоставление между мишенями и праймерами. В процессе поиска Primer-BLAST проверил в общей сложности 355744 совпадения BLAST (см. Легенду на Рисунке 3), которые представляют не только варианты транскриптов этого гена, но также большое количество транскриптов из других генов, которые показывают совпадения в различной степени с кандидатом. грунтовки. Это подчеркивает проблему, если такая же тщательная проверка специфичности праймера должна выполняться вручную.Среднее время поиска для создания новых праймеров с параметрами по умолчанию с использованием шаблона мРНК человека средней длины (2800-3000 оснований) составляет 2,6 минуты.

Рисунок 2

Схематическое выравнивание вариантов транскриптов мРНК из гена ZNF419. Числа указывают конечные положения экзонов для варианта 5. Красные линии указывают области праймеров, выбранные Primer-BLAST. Обратите внимание, что несколько транскриптов отличаются на 3 нуклеотида из-за использования немного разных сайтов сплайсинга, даже если они имеют одни и те же экзоны (т.е., вариант 2 в.с. вариант 1, вариант 7 в.с. вариант 6 и вариант 4 против. вариант 3). График адаптирован из отчета NCBI по генам (http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_report&list_uids=79744. Данные по состоянию на 11.02.2011).

Фигура 3

Пример результатов разработки специфичных для мишени праймеров. Обратите внимание, что хотя было возвращено пять пар праймеров (как показано в графическом обзоре), из-за ограниченного пространства на рисунке показаны детали только для первой пары праймеров.Ссылка «Сводка поиска» при нажатии показывает используемые параметры поиска, а также общее количество совпадений BLAST, сгенерированных в процессе поиска (355 744 совпадений для текущего поиска). Цифры в выравнивании указывают начальное и конечное положения праймера и мишени. Точка (.) Указывает идентичность нуклеотидов с последовательностью праймера. Обыск производился 02.11.2011.

Исследование выравнивания варианта транскрипта 5 с другими вариантами показывает, что наличие экзона 2 и отсутствие экзона 4 в сочетании являются единственными особенностями, которые отличают его от остальных (рис. 2).Неудивительно, что часть или все прямые праймеры, выбранные Primer-BLAST, расположены в экзоне 2, а все обратные праймеры находятся на стыках между экзоном 3 и 5 (поскольку экзон 4 отсутствует).

Primer-BLAST также можно использовать для проверки специфичности уже существующих праймеров. В качестве примера мы получили праймеры для той же матрицы ПЦР, что и выше (т. Е. МРНК варианта 5 транскрипта ZNF419) из PrimerBank, который депонирует множество предварительно рассчитанных ген-специфических праймеров для обнаружения мРНК [16]. Опять же, были использованы параметры специфичности по умолчанию, и результат представлен на рисунке 4.В результате поиска было получено 11 236 совпадений BLAST из базы данных мРНК RefSeq с организмом, ограниченным человеческим организмом, что еще раз демонстрирует сложность ручного анализа результатов BLAST даже для одной пары праймеров. Эта пара праймеров действительно демонстрирует идеальные совпадения с вариантом 5 транскрипта гена ZNF419, а также с другими вариантами транскрипта того же гена и может генерировать ампликон из 444 оснований. Это согласуется с критериями отбора PrimerBank, согласно которым праймеры специфичны только на уровне гена, а не на уровне транскрипта.Интересно, что обнаруживаются и другие потенциальные ампликоны. Один из них представляет собой дополнительный ампликон из 780 оснований, присутствующий в предполагаемом транскрипте ZNF419. Другой — это ампликон из 444 оснований из другого гена (т. Е. Белка 773 цинкового пальца человека, номер доступа в Genbank NM_198542.1). Однако существует до 5 несовпадений по крайней мере между одним из праймеров и мишенями, что, вероятно, достаточно для предотвращения интерференции амплификации или неспецифической амплификации. Тем не менее, пользователи могут внимательно изучить этот результат и сделать выводы, основываясь на собственном экспериментальном опыте.

Рисунок 4

Проверка специфичности существующих праймеров. Этот поиск был выполнен путем ввода прямого и обратного праймеров без ввода какого-либо шаблона. Праймеры (прямой праймер: GTAGGACTGCTCAGTTCAAACAT, обратный праймер: ACAGTTACTACACCCGTAAGGC) были получены из PrimerBank (http://pga.mgh.harvard.edu/primerbank/) 11.02.2011 с использованием варианта 5 транскрипта ZNF419 (доступ в GenBank NM_001098494). Хотя результаты показали, что все 7 вариантов транскриптов гена ZNF419 имеют одинаковые ампликоны, на этом рисунке показаны детали только для вариантов 1 и 5 из-за ограниченного пространства.Текущий поиск сгенерировал 11 236 совпадений BLAST (выполнено 11.02.2011).

Сравнение с другими инструментами для разработки праймеров

Primer-BLAST предлагает ряд функций, которые недоступны в других программных инструментах. В таблице 1 дается краткое изложение этих характеристик, многие из которых важны для различных требований к конструкции праймеров и позволяют пользователям изучить детали специфичности праймера. Например, Primer-BLAST — единственный инструмент, который предлагает возможность указывать количество несовпадений, которые должна иметь конкретная пара праймеров с непреднамеренными целями, и настраиваемая 3 ’концевая область, где должно присутствовать определенное количество несовпадений.Этот вариант важен для удовлетворения различных требований пользователей к строгости специфичности праймера, поскольку специфичность праймера обычно оценивается по количеству несоответствий, которые он имеет с непреднамеренными целями (большее количество несоответствий дает большую специфичность), и местоположением таких несоответствий (несоответствия). ближе к 3 ‘концу предлагаю больше конкретики). Primer-BLAST — единственная программа из трех, которая будет размещать праймеры на разных экзонах (т. Е. Для охвата интрона), чтобы избежать амплификации геномной ДНК, а также единственная программа, позволяющая настраивать количество совпадений нуклеотидов с обеих сторон соединение экзон / экзон.Кроме того, Primer-BLAST представляет подробное сопоставление найденных праймеров и мишеней.

Таблица 1 Сравнение выбранных функций различных инструментов для проектирования грунтовок

Еще одно преимущество Primer-BLAST — высокая чувствительность обнаружения. Как показано выше, Primer-BLAST по умолчанию способен обнаруживать потенциальные мишени амплификации, которые имеют до 5 несовпадений с праймером. Primer-Blast достигает этого результата за счет использования высокочувствительных параметров BLAST, а также дополнительного алгоритма глобального выравнивания NW для обеспечения полного выравнивания между праймером и его мишенью.Однако есть одно предостережение: алгоритм BLAST [6] требует минимального количества совпадений нуклеотидов (размера слова) между запросом и целью, и любые инструменты, использующие BLAST в качестве алгоритма поиска, подпадают под это ограничение. Следовательно, Primer-BLAST (с параметрами по умолчанию) пропустит любые цели, у которых есть 6 или меньше последовательных совпадений с праймером (поскольку Primer-BLAST использует размер слова 7 по умолчанию). Например, если цель имеет несовпадения с праймером из 20 оснований в положениях 7 и 14 (при условии, что конец 5 ‘находится в позиции один), цель будет пропущена Primer-BLAST (с параметрами по умолчанию), даже если у нее только 2 несоответствия.Предполагая случайное распределение местоположений несовпадений, можно вычислить количество возможных расположений из 18 совпадений и 2 несовпадений. Существует 20 * 19 различных способов разместить 2 несоответствия среди 18 совпадений, но только 2 из них приводят к размеру слова меньше 7, поэтому вероятность пропуска цели с 2 несовпадениями с праймером из 20 оснований равна 2 / (20 * 19) или около 0,5%.

Далее мы сравним чувствительность обнаружения цели между Primer-BLAST и другими инструментами для разработки праймеров, такими как QuantPrime и PRIMEGENS.В идеале сравнение чувствительности обнаружения должно заключаться в непосредственном тестировании модулей проверки специфичности во всех инструментах с использованием праймеров, созданных третьей стороной (например, праймеров, созданных с помощью Primer3). К сожалению, этот вариант недоступен, поскольку Primer-BLAST — единственный инструмент, который предлагает прямую проверку специфичности (то есть проверку специфичности уже существующих праймеров). В качестве альтернативы мы использовали QuantPrime и PRIMEGENS для создания специфичных для мишени праймеров, а затем использовали Primer-BLAST для исследования этих праймеров на предмет потенциальных мишеней.Если Primer-BLAST не находит других целей, кроме предполагаемой (т.е. самой входной матрицы мРНК), то можно сделать вывод, что QuantPrime и PRIMEGENS по крайней мере так же чувствительны, как Primer-BLAST. С другой стороны, наличие непреднамеренных целей, обнаруженных с помощью Primer-BLAST, может указывать на то, что эти инструменты не так чувствительны, как Primer-BLAST, в чувствительности обнаружения целей (поскольку эти инструменты уже исследовали такие цели, но не смогли избежать их во время их выбора. процессы для специфичных для мишени праймеров).

Тестовые шаблоны выбираются случайным образом из базы данных мРНК NCBI Refseq, и они включают 52 человеческие последовательности для тестирования QuantPrime и 24 последовательности Arabidopsis thaliana для тестирования PRIMEGENS (поскольку PRIMEGENS не поддерживает человеческие последовательности). Как показано в таблице 2, QuantPrime или PRIMEGENS сгенерировали пары праймеров для большинства тестовых случаев, которые они сочли специфичными для входных шаблонов. Однако Primer-BLAST выявил, что многие из них (13,4% пар праймеров из QuantPrime и 43,3% пар праймеров из PRIMEGENS) имеют потенциальные непреднамеренные мишени, которые показывают от одного до пяти несовпадений нуклеотидов.В результате большая часть тестовых примеров имеет по крайней мере одну пару праймеров, которая имеет потенциальные непреднамеренные цели (31,5% для QuantPrime и 93,3% для PRIMEGENS). Некоторые мишени имеют только одно или два несовпадения с праймерами, полученными из QuantPrime (18,5%), хотя эта часть намного меньше для PRIMEGENS (3,4%).

Таблица 2 Сводка потенциальных непреднамеренных мишеней для пар праймеров, о которых сообщили QuantPrime и PRIMEGENES a

На рисунке 5 показаны детали для 5 потенциальных непреднамеренных целей.Например, QuantPrime генерирует две пары праймеров (пример 1 и 2), которые разработаны, чтобы быть специфичными для доступа Genbank NM_182690.2 и NM_001039567.2, соответственно (рисунок 5). Однако Primer-BLAST показывает, что эти две пары имеют потенциальные непреднамеренные мишени, NM_005227.2 и NM_001008.3, соответственно, которые имеют только одно нуклеотидное несоответствие прямому или обратному праймерам. Пара праймеров, созданная PRIMEGENS (пример 4), также показывает потенциальную непреднамеренную мишень только с одним несоответствием.Как было рассмотрено ранее, несоответствие одного нуклеотида (даже на 3 ’конце) не оказывает значительного влияния на амплификацию мишени, и поэтому эти пары праймеров вряд ли будут специфичными для предполагаемых мишеней. Неспособность обнаружить единственное несоответствие оснований (нуклеотидное основание G в примере 1) или около 3 ’конца (нуклеотидное основание C в примере 2) показывает недостаток использования только алгоритма локального выравнивания. Локальное выравнивание пытается максимизировать результат, который оно возвращает, поэтому оно не будет включать несоответствия в или (возможно) ближе к концу выравнивания, поскольку они уменьшили бы общую оценку [6].Другие случаи непреднамеренных мишеней включают 2 несовпадения (пример 3) или 5 несовпадений (пример 5) с одним из праймеров.

Рисунок 5

Примеры потенциальных непреднамеренных мишеней для пар праймеров, созданных QuantPrime и PRIMEGENS. Примеры мишеней извлекаются из результатов проверки специфичности Primer-BLAST для пар праймеров, созданных с помощью QuantPrime или PRIMEGENS (всего было идентифицировано 162 и 116 потенциальных непреднамеренных мишеней для QuantPrime и PRIMEGENS, соответственно.См. Подробности в таблице 2). Примеры праймеров соответствуют тем, которые подчеркнуты в дополнительных файлах 1 и 2.

Таким образом, мы делаем вывод, что Primer-BLAST способен обнаруживать потенциальные непреднамеренные цели, которые не попадают в поле зрения QuantPrime или PRIMERGENS во время процесса скрининга специфичности.

Оптимизация наборов праймеров и протоколов обнаружения SARS-CoV-2 коронавирусной болезни 2019 (COVID-19) с использованием ПЦР и ПЦР в реальном времени

Рекомендации по разработке и оптимизации праймеров

В предыдущем исследовании мы признали важность процесс проверки и оптимизации наборов праймеров, используемых для тестирования на вирусы.Таким образом, в этом исследовании мы сначала описываем подробные рекомендации по разработке и оптимизации наборов праймеров в три важных этапа (рис. 1a). Первым шагом является выбор целевых генов ( RdRP , N , E и S ) для обнаружения в интересующем геноме (SARS-CoV-2) и создание праймера на основе целевой последовательность каждого гена. Для оптимальной целевой последовательности, когда в транскрипте гена присутствует вариант сплайсинга, предпочтительна целевая область в более распространенном варианте сплайсинга.Для фактического дизайна праймера использовались различные инструменты, доступные на веб-сайте Primer3 (http://primer3.wi.mit.edu). Primer3 позволяет выбрать оптимальный праймер на основе T m , длины праймера и стабильности 3′-конца, которые следует учитывать при разработке каждого набора праймеров. Второй этап — это проверка in silico последовательностей праймеров и ампликонов. Идентификация вторичной структуры ампликона и возможность образования само- или гетеродимера самой последовательностью праймера были предсказаны на другом веб-сайте, idtdna.com (https://sg.idtdna.com/pages/tools/oligoanalyzer). На этом сайте тенденцию к само- или гетеродимеризации можно оценить, рассчитав значение ΔG. Наконец, на веб-сайте gemone.ucsc.edu (https://genome.ucsc.edu/cgi-bin/hgPcr) инструмент ПЦР in silico можно использовать для прогнозирования возможности неспецифических реакций в том же геноме, а также геномы разных видов. Третий шаг — экспериментальное подтверждение и оптимизация набора праймеров в биологической лаборатории. Мы оптимизировали условия ПЦР, такие как температура отжига ( T a ), с помощью градиентной ПЦР, установив температуры отжига от 50 до 65 ° C и определив температуру, при которой была достигнута максимальная амплификация.В качестве меры предосторожности важно отметить, что конечная концентрация праймера, установленного в смеси для ПЦР, является критической для целевой ПЦР. При концентрациях, превышающих оптимальную, праймеры могут образовывать димеры и мешать специфичной для мишени ПЦР. Следовательно, для каждого набора праймеров необходимо тестировать концентрации в диапазоне от 100 до 500 нМ на образование димеров. При подтверждении результата ПЦР с помощью электрофореза необходимо проверить эффективность реакции на основании того, являются ли размер полосы ампликона и количество добавленного шаблона подходящим или нет.

Рис. 1. Рекомендации по созданию и оптимизации праймеров для ПЦР, карта генома SARS-CoV-2 и мишени для наборов праймеров.

a Трехэтапное руководство по конструированию и оптимизации праймеров для ПЦР. Шаг 1: гены-мишени были выбраны из геномных баз данных, и были созданы праймеры с использованием Primer3. Шаг 2: наборы праймеров были оптимизированы in silico, чтобы избежать вторичной структуры в праймерах или нецелевой амплификации. Шаг 3: разработанные праймеры были оптимизированы на уровне влажной лаборатории для достижения высокой специфичности и эффективности обнаружения мишеней. b Расположение генов-мишеней и выбранных наборов праймеров в геноме SARS-CoV-2. c Структура SARS-CoV-2 с указанием каждого белка и его названия.

Чтобы продемонстрировать важность процедуры оптимизации праймеров, мы провели ПЦР (35 циклов) с использованием различных наборов неоптимальных праймеров с матричной ДНК или без нее (кДНК SARS-CoV-2) и в различных условиях T a (рис. ). Первый пример продемонстрировал появление ложного образования праймер-димер (рис.2а). Димер праймера — это побочный продукт ПЦР, состоящий из молекул праймера, которые гибридизуются друг с другом из-за цепочек комплементарных оснований в праймерах 22 . В первом примере мы провели ПЦР с ранее описанным набором праймеров SARS-CoV-2_IBS_RdRP1 9 . Полученные данные электрофореза показали появление ложных коротких димерных полос примерно на 30–50 пар оснований (п.н.) вместе с темной полосой с ожидаемым размером ампликона 118 п.н. в условиях шаблона (рис.2а). Фактически, полосы праймер-димер были обнаружены во всех условиях, независимо от присутствия матрицы. Кроме того, интенсивность полос праймер-димер имела тенденцию к снижению с повышением температуры. Появление полос праймер-димер позволяет предположить, что концентрация праймера и T a не является оптимальной и ее необходимо оптимизировать путем уменьшения концентрации праймера и увеличения T a .

Рис. 2: Примеры результатов теста неоптимального набора праймеров с использованием ПЦР.

Результаты электрофореза после ПЦР (35 циклов) с различными наборами неоптимальных праймеров с матричной ДНК или без нее (кДНК SARS-CoV-2) и в различных условиях T и . a Пример появления димеров коротких праймеров во всех условиях, выполненный с набором праймеров SARS-CoV-2_IBS_RdRP1. b Пример появления димеров коротких и длинных праймеров под низким T a , с набором праймеров SARS-CoV-2_IBS_S1. c Пример появления длинных димеров праймеров под низким T a , с набором праймеров SARS-CoV-2_IBS_E1. d Пример низкоэффективных праймеров в ПЦР, проводимой с набором праймеров CDC_RNAse P. e Пример появления неспецифической полосы при низком уровне T a в ПЦР, проведенной с набором праймеров SARS-CoV-2_IBS_N1. Красные звездочки указывают на длинные димеры праймеров.

Второй пример продемонстрировал появление ложного длинного димера вместе с более короткой полосой праймер-димер (рис.2б, в). В этих примерах мы провели ПЦР с ранее опубликованными наборами праймеров SARS-CoV-2_IBS_S1 (рис. 2b) и SARS-CoV-2_IBS_E1 (рис. 2c) 9 . Хотя в условиях, включая матричную ДНК, были сильные положительные полосы ожидаемого размера, длинные димерные полосы появлялись при низком T a = 50 ° C и 55 ° C, но не при высоком T a = 60 ° C, в условиях отсутствия шаблона (красные звездочки на рис. 2б, в). Эти результаты предполагают, что, когда набор праймеров показывает возможность образования длинного побочного продукта ПЦР, этого можно предотвратить, увеличив T a .

Третий пример показал набор малоэффективных праймеров. В этом примере мы провели ПЦР с ранее описанным набором праймеров CDC_RNAse P 9 (фиг. 2d). Полученные данные электрофореза показали, что во всех условиях наблюдались сильные ложные длинные и короткие полосы праймеров и слабые полосы или их отсутствие (рис. 2d). Появление этих сильных полос праймеров указывает на то, что набор праймеров проявляет тенденцию к чрезмерной димеризации, которая сильнее, чем его тенденция к гибридизации с матрицей.Эти результаты предполагают, что этот набор праймеров следует выбросить, а новый набор праймеров должен быть разработан и оптимизирован.

Последний пример продемонстрировал появление очень длинной неспецифической полосы. В этом примере мы провели ПЦР с SARS-CoV-2_IBS_N1. Полученные данные электрофореза показали отсутствие полосы праймер-димер и сильную ожидаемую полосу в условиях, содержащих матричную ДНК (рис. 2e). Однако была ложная очень длинная неспецифическая полоса около 400 п.н. при низком T a = 50 ° C и 55 ° C, но не при высоком T a = 60 ° C в отсутствие матричная ДНК (рис.2д). Отсутствие полосы праймер-димер указывает на то, что сам набор праймеров является оптимальным набором праймеров. Однако наличие неспецифической полосы при низком уровне T a предполагает, что оптимальное значение T a было выше и было близко к T a = 60 ° C.

Таким образом, наборы праймеров, которые демонстрируют образование праймер-димер, можно просто оптимизировать, увеличив T a , тогда как набор праймеров, используемый на рис. 2d, необходимо изменить.Без оптимизации образующиеся ложные димеры праймеров и побочные продукты могут привести к появлению ложноположительной кривой при высоких значениях C t , близких к 35 циклам, и низких температурах плавления, независимо от наличия или отсутствия шаблон в ПЦР в реальном времени 23 . При разработке нового набора праймеров можно следовать трехэтапным рекомендациям, которые мы предложили на рис. 1а.

Дизайн и оптимизация праймера SARS-CoV-2

В этом исследовании мы планировали разработать протокол обнаружения для традиционной ПЦР, а также ПЦР в реальном времени.Кроме того, мы планировали разработать протокол обнаружения для мультиплексной ПЦР, а также мультиплексной ПЦР в реальном времени. Мы разработали и оптимизировали наборы праймеров для каждого протокола в соответствии с рекомендациями, показанными на рис. 1а. Список недавно разработанных наборов праймеров, а также наиболее оптимизированные наборы праймеров из предыдущего исследования 9 показаны в таблице 1. Наши наборы праймеров были разработаны специально для SARS-CoV-2, поэтому они не нацелены на другие коронавирусы человека. , таких как человеческий коронавирус OC43 (HCoV-OC43), человеческий коронавирус NL63 (HCoV-NL63), человеческий коронавирус HKU1 (HCoV-HKU1) и человеческий коронавирус 229E (HCoV-229E).

Среди наборов праймеров, которые были разработаны для обнаружения SARS-CoV-2 в реальном времени в предыдущем исследовании 9 , некоторые наборы праймеров были повторно оценены и отобраны на основе рекомендаций по дизайну и оптимизации представлены на рис. 1а (табл. 1). Используя выбранные наборы праймеров, мы провели традиционную ПЦР, как показано на фиг. 3, и ПЦР в реальном времени, как показано на фиг. 4, 5. Кроме того, новые наборы праймеров позволили получить ампликоны размером от 100 до 400 пар оснований.Эти новые наборы праймеров нацелены на гены RdRP , E , N и S SARS-CoV-2 (рис. 1b, c) и были использованы для мультиплексной ПЦР на рис. 6 (таблица 1) . Для обнаружения человеческого IPC мы разработали новые наборы праймеров, нацеленные на гены ACTB (актин бета), TBP (TATA-Box Binding Protein), 18S рРНК и GAPDH гены Homo sapiens ( Таблица 1). Эти наборы праймеров IPC использовали для контроля качества добровольной кДНК образца и проверки ПЦР.Новые наборы праймеров для множественной ПЦР-детекции были оптимизированы, как показано на фиг. 6a, b, в соответствии с рекомендациями, показанными на фиг. 1a.

Рис. 3: Разработка традиционного протокола ПЦР для обнаружения SARS-CoV-2.

Результаты гель-электрофореза в результате ПЦР (35 циклов) с использованием наборов праймеров SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1. Праймеры GAPDH использовали в качестве набора праймеров IPC. Прогнозируемый размер ампликонов составлял примерно 100 п.н. Пять нанограммов кДНК SARS-Cov-2 (4.5 × 10 8 копий / реакция) или кДНК HEK-293T (1,5 × 10 3 копий / реакция) использовали для каждой реакции. Условие отсутствия матрицы не содержало кДНК.

Рис. 4: Улучшение протокола обнаружения ПЦР в реальном времени для SARS-CoV-2.

ПЦР в реальном времени выполняли с использованием наборов праймеров SARS-CoV-2 SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1. Набор праймеров GAPDH использовали в качестве набора праймеров IPC. Каждая строка представляет каждый набор праймеров.Слева каждый график представляет собой график амплификации, который показывает изменение значений log (ΔRn) в зависимости от номера цикла ПЦР. Ось Y представляет нормализованное репортерное значение (Rn), которое было рассчитано как сигнал флуоресценции от SYBR Green, нормализованный к сигналу флуоресценции эталонного красителя. Графики справа представляют графики кривой плавления, которые отображают данные, собранные на этапе кривой плавления. Пики на кривой плавления могут указывать на температуру плавления ( T m ) мишени или идентифицировать неспецифическую ПЦР-амплификацию.На оси Y производное репортера (-Rn ‘) вычисляли как отрицательную первую производную Rn, генерируемую репортером во время ПЦР-амплификации. Зеленая кривая соответствует образцу кДНК U добровольца. Синяя кривая — кДНК SARS-CoV-2. Пурпурная кривая соответствует условию отсутствия шаблона. Все данные представлены как среднее ± S.E.M.

Рис. 5: Разработка протокола обнаружения мультиплексной ПЦР в реальном времени для SARS-CoV-2.

Мультиплексные результаты ПЦР в реальном времени для наборов праймеров SARS-CoV-2 SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1.Набор праймеров GAPDH использовали в качестве набора праймеров IPC. Графики слева представляют графики амплификации. Графики справа представляют собой графики кривых плавления. Конечная концентрация смеси праймеров составляла 500 нМ. Зеленая кривая соответствует образцу кДНК U добровольца. Синяя кривая — кДНК SARS-CoV-2. Пурпурная кривая соответствует условию отсутствия шаблона. Все данные представлены как среднее ± S.E.M.

Рис. 6: Оптимизация и разработка протокола мультиплексной ПЦР для обнаружения SARS-CoV-2.

, B Гель-электрофорез результаты ПЦР с наборов праймеров SARS_CoV-2_IBS_m_RdRP 1, SARS_CoV-2_IBS_m_RdRP 2, SARS_CoV-2_IBS_m_S 1, SARS_CoV-2_IBS_m_S 2, SARS_CoV-2_IBS_m_N 1, SARS_CoV-2_IBS_m_N 2, 18S рРНК , IBS_m_ACTB 1, IBS_m_ACTB 2, IBS_m_TBP 1 и IBS_m_TBP 2. Ожидаемые размеры продуктов ПЦР указаны в таблице 1. c , d Результаты гель-электрофореза, полученные в результате мультиплексной ПЦР в SARS-CoV-2, HEK-293T, Voulteer U и реакции без матрицы с использованием смеси из четырех наборов праймеров для обнаружения c SARS-CoV-2 (SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_m_RdRP 1, SARS-CoV-2_IBS_m_S 1 и SARS- CoV-2_IBS_m_N 1). d Смесь трех наборов праймеров использовали для обнаружения человеческого IPC (IBS_m_TBP 1, IBS_m_ACTB 1 и 18S рРНК). Расположение каждого предсказанного продукта ПЦР в геле указано справа.

Разработка традиционного протокола ПЦР для обнаружения SARS-CoV-2

Для разработки традиционного протокола обнаружения ПЦР для SARS-CoV-2, который может быть легко реализован в любой биологической лаборатории по всему миру, мы разработали протокол на основе ПЦР с использованием лучшие наборы праймеров среди ранее разработанных наборов праймеров 9 после оптимизации каждого набора праймеров в соответствии с рекомендациями, показанными на рис.1а. Мы использовали кДНК SARS-CoV-2 в качестве положительного контроля, кДНК человеческого происхождения HEK-293T в качестве человеческого IPC и CDC_RNAae P (рис. 2d) в качестве праймер-димерного контроля. Мы провели ПЦР (35 циклов) для каждого набора праймеров с использованием полимеразы Taq (рис. 3). Результаты электрофореза показали, что наборы праймеров SARS-CoV-2 SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1 давали только темные полосы соответствующего размера (~ 100 п.н.) в присутствии матрицы кДНК SARS-CoV-2, а не в условиях кДНК HEK-293T или без матрицы (рис.3). Наборы праймеров SARS-CoV-2 человека IPC показали несколько признаков образования ложных праймер-димерных полос (рис. 3), что указывает на то, что набор праймеров был высоко оптимизирован по сравнению с неоптимизированными наборами праймеров. Мы использовали праймеры GAPDH в качестве набора праймеров IPC человека и обнаружили, что, хотя наборы праймеров SARS-CoV-2 не давали детектируемой полосы с кДНК HEK-293T, набор праймеров GAPDH давал положительную полосу в присутствии кДНК HEK-293T ( Рис.3). Результаты GAPDH показали, что кДНК HEK-293T была приготовлена ​​должным образом.Поскольку геномная РНК SARS-CoV-2 была первоначально получена из клеточной линии Vero, выделенной из эпителиальных клеток почек, выделенных из африканской зеленой обезьяны ( макака-резус ) 19 , положительная полоса GAPDH была получена в присутствии SARS- КДНК CoV-2 указывала на то, что кДНК клетки Vero была случайно включена в кДНК SARS-CoV-2 (рис. 3). Это было подтверждено с помощью инструмента ПЦР in silico, как показано на рис. 1а. Взятые вместе, результаты показали, что мы разработали традиционный протокол обнаружения SARS-CoV-2 на основе ПЦР, который можно будет использовать во всем мире в любой биологической лаборатории, оснащенной обычным ПЦР-аппаратом.

Улучшение протокола обнаружения ПЦР в реальном времени для SARS-CoV-2

В нашем предыдущем отчете мы предоставили 9 уникальных наборов праймеров, нацеленных на SARS-CoV-2 9 . Однако эти наборы праймеров не были оптимизированы в соответствии с рекомендациями, показанными на рис. 1а. Поэтому в этом исследовании мы оптимизировали и выбрали лучшие наборы праймеров в попытке улучшить протокол на основе ПЦР в реальном времени. Используя выбранные наборы праймеров для SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1, мы провели ПЦР в реальном времени для каждого набора праймеров и Volunteer U или SARS-CoV- 2 образца кДНК или контроль без матрицы (рис.4). Результаты ПЦР в реальном времени отображаются на двух отдельных графиках для каждого набора праймеров: график амплификации и график кривой плавления (рис. 4). График амплификации показывает изменение значений log (ΔRn) в зависимости от номера цикла ПЦР, тогда как график кривой плавления показывает динамику плавления диссоциации цепей ДНК и последующего высвобождения ДНК, связанной с красителем SYBR® Green I 24 . Форма и положение этой кривой плавления ДНК зависят от соотношения GC / AT, длины и последовательности и могут использоваться для дифференциации ампликонов, разделенных менее чем на 2 ° C при температуре плавления 24 .Результаты амплификации и график кривой плавления для каждого набора праймеров показали отсутствие достоверно положительного сигнала при значениях C t ниже 37 для всех четырех наборов праймеров SARS-CoV-2 (SARS-CoV2_IBS_RdRP2, SARS-CoV2_IBS_S2 , SARS-CoV2_IBS_E2 и SARS-CoV2_IBS_N1), тогда как при использовании кДНК образца U добровольца был положительный сигнал для GAPDH (зеленая кривая, рис. 4; дополнительная таблица 1). Это сильно контрастировало со значительно положительными сигналами, полученными с кДНК SARS-CoV-2 (синяя кривая, рис.4). Положительные сигналы на графике амплификации последовательно представлены острыми пиками на соответствующем графике кривой плавления (рис. 4). Несоответствие между положениями пиков на кривых плавления GAPDH для образцов SARS-CoV-2 и Volunteer U, скорее всего, было связано с 11% -ной разницей в последовательностях ампликонов между двумя видами приматов ( Homo sapiens и макака-резус ), на что указывает ПЦР in silico (дополнительная таблица 1). Для определения наличия SARS-CoV-2 мы использовали те же критерии, которые описаны в предыдущей статье 9 : если был обнаружен какой-либо один из генов SARS-CoC-2, он записывался как «обнаружен SARS-CoV-2. », Или, если обнаружен только ген IPC человека, он был записан как« SARS-CoV-2 НЕ обнаружен ».Основываясь на этих результатах и ​​применяемых критериях, мы пришли к выводу, что доброволец U, скорее всего, был отрицательным по SARS-CoV-2. Взятые вместе, эти результаты показывают, что использование оптимизированных наборов праймеров вместе с анализом кривой плавления может обеспечить улучшенный протокол обнаружения SARS-CoV-2 без ложных срабатываний.

Разработка протокола мультиплексной ПЦР в реальном времени для обнаружения SARS-CoV-2

Используя оптимизированные наборы праймеров для ПЦР в реальном времени, мы попытались разработать альтернативный протокол обнаружения, приняв мультиплексную ПЦР в реальном времени, в которой все наборы праймеров смешивают в одном реакционном буфере.Разработав протокол мультиплексной ПЦР в реальном времени, мы рассчитывали сократить необходимое количество образца и реагентов, время подготовки, стоимость и трудозатраты. Для получения смеси с набором праймеров мы смешали все наборы праймеров, нацеленных на SARS-CoV-2, вместе в реакционном буфере, и набор праймеров IPC растворяли отдельно в реакционном буфере. Таким образом, нам удалось снизить общее количество реакций с 15 до 6, когда мы приняли метод мультиплексирования. Чтобы уменьшить образование праймер-димер, когда все наборы праймеров были смешаны вместе, мы пропорционально уменьшили концентрацию каждого набора праймеров, так что конечная концентрация всех наборов праймеров составила 500 нМ (по 125 нМ каждый).В остальном процедура была такой же, как и для ПЦР в реальном времени. Мы получили очень похожие результаты на графиках амплификации для мультиплексной ПЦР в реальном времени (рис. 5), что и результаты, полученные с помощью ПЦР в реальном времени (рис. 4). В частности, график амплификации показал одну объединенную кривую реакции для всех четырех наборов праймеров со значительно более низким значением C t (фиг. 5; дополнительная таблица 1) по сравнению с таковой для каждого набора праймеров (фиг. 4). Точность эксперимента была подтверждена графиком кривой плавления, поскольку кривая плавления для положительного сигнала показывала несколько пиков, причем каждый пик представлял каждый ампликон для соответствующего набора праймеров (рис.4, 5; Дополнительная таблица 1). Основываясь на этих результатах, мы пришли к выводу, что доброволец U, скорее всего, был отрицательным на SARS-CoV-2. Взятые вместе, результаты демонстрируют, что недавно разработанный протокол мультиплексной ПЦР в реальном времени можно использовать для быстрого и точного обнаружения SARS-CoV-2 в качестве экономичной альтернативы протоколу ПЦР в реальном времени.

Разработка протокола мультиплексной ПЦР для обнаружения SARS-CoV-2

В качестве альтернативы традиционному протоколу на основе ПЦР мы дополнительно разработали протокол обнаружения SARS-CoV-2 на основе мультиплексной ПЦР, в котором все наборы праймеров были смешанные вместе в реакционном буфере.Чтобы визуализировать и разделить каждый ампликон каждого набора праймеров, мы разработали новые наборы праймеров, нацеленные на гены RdRP , S и N в геноме SARS-CoV-2, где каждый набор праймеров продуцировал ампликон другого типа. размер (т.е. 200, 300 и 400 п.н соответственно). Для набора праймеров, нацеленного на ген E , использовали ранее описанный набор праймеров SARS-CoV-2_IBS_E2, продуцирующий ампликон длиной 116 п.н. (Таблица 1). Для наборов праймеров IPC человека мы аналогичным образом разработали новые наборы праймеров, нацеленные на 18 S рРНК , ACTB и TBP с размерами ампликонов 200, 300 и 400 пар оснований соответственно.Все наборы праймеров IPC человека включали последовательности праймеров, общие с африканской зеленой обезьяной ( макака-резус ), за исключением набора праймеров IBS_m_TBP 1. Для оптимизации недавно разработанных наборов праймеров мы провели ПЦР (35 циклов) с кДНК SARS-CoV-2 в качестве положительного контроля и кДНК человеческого происхождения HEK-293T в качестве человеческого IPC (рис. 6a, b). Результаты электрофореза показали положительные темные полосы соответствующего размера и отсутствие димеров праймеров в присутствии кДНК SARS-CoV-2 или HEK-293T, хотя некоторые наборы праймеров показали продуцируемые димеры праймеров в условиях отсутствия матрицы (рис.6а, б). Эти результаты показали, что все наборы праймеров были высокооптимизированы, показывая высокую эффективность амплификации и низкую тенденцию к образованию собственных или гетеропраймер-димеров. Основываясь на низком или полном отсутствии образования праймер-димерной полосы и высокой интенсивности полосы ампликона, мы выбрали следующие лучшие наборы праймеров для протокола обнаружения SARS-CoV-2 на основе мультиплексной ПЦР: SARS_CoV-2_IBS_m_RdRP 1 ( RdRP ), SARS_CoV- 2_IBS_m_S 1 ( S ), SARS_CoV-2_IBS_m_N 1 ( N ), 18S рРНК ( 18S рРНК ), IBS_m_ACTB 1 ( ACTB ) и IBS_m_TBP 1 ().

Используя выбранные наборы праймеров на этапе оптимизации, мы затем провели мультиплексную ПЦР для обнаружения SARS-CoV-2. Для мультиплексной ПЦР мы смешали все наборы праймеров, нацеленных на SARS-CoV-2, вместе в реакционном буфере, и наборы праймеров IPC человека растворяли отдельно в реакционном буфере, чтобы получить конечную общую концентрацию набора праймеров 500 нМ в обоих случаях. Верхние результаты электрофореза показали четыре положительных полосы соответствующего размера для каждого праймера SARS-CoV-2, установленного на одной дорожке в присутствии кДНК SARS-CoV-2 (рис.6в). За исключением положительной полосы, полученной с набором праймеров SARS-CoV-2_IBS_E2, другие три набора праймеров давали высокоинтенсивные положительные полосы (фиг. 6c). Это согласуется с недавним отчетом о том, что экспрессия гена E в SARS-CoV-2 очень низкая 18 . Напротив, не было никаких признаков положительной полосы в кДНК HEK-293T, кДНК U добровольца или в условиях отсутствия матрицы (фиг. 6c). В соответствии с результатами, представленными на рис. 6a, b, не было никаких признаков образования праймер-димер.Результаты электрофореза для наборов праймеров IPC человека показали, что существует по крайней мере одна положительная полоса в условиях кДНК U, HEK-293T и SARS-CoV-2, но не в условиях отсутствия матрицы (рис. 6d), проверка надежного извлечения РНК из добровольного образца. Основываясь на этих результатах, мы пришли к выводу, что доброволец U, скорее всего, был отрицательным на SARS-CoV-2. Взятые вместе, результаты демонстрируют, что недавно разработанный протокол мультиплексной ПЦР с оптимизированными наборами праймеров может быть полезен для быстрого, легкого доступа и визуально проверяемого обнаружения SARS-CoV-2.

CARPRO Essence: EXTREME Gloss Primer 1 литр (34 унции)

Будущее глянца …

CARPRO снова крутит колеса инноваций !! CARPRO Essence — это уникальная смесь нанотехнологического кварца, высокоглянцевых прочных смол и мелких абразивов, которые смешиваются на микроскопическом уровне и образуют нечто действительно революционное! CARPRO Essence оставляет потрясающее глянцевое покрытие с полуперманентными наполнителями и встроенными защитными свойствами!

В сочетании с подушечкой для резки из микрофибры CARPRO Essence обеспечивает неожиданную режущую способность, а глянцевая подушечка CARPRO Gloss Pad, оснащенная Essence, обеспечивает блеск, о котором мы могли только мечтать до сих пор! Но это не просто полироль…

Меньше времени, затрачиваемого на полировку автомобиля обычными средствами, CARPRO Essence способна удалить завихрения, сделать лак более толстым, придать более высокий блеск и создать полуперманентный защитный слой! Ох… и стирается, как сон!

Essence также оставляет идеально гладкий, глубокий, отражающий, загрунтованный слой, на который можно наносить CQUARTZ или CARPRO Reload! Атрибут грунтовки в Essence делает нанесение CQUARTZ проще, чем когда-либо, и бесшовно склеивается, образуя оболочку с невероятным блеском и защитой!

Характеристики:
  • Грунтовка поверхности для CQUARTZ или CARPRO Reload.
  • Обеспечивает чрезвычайно высокий блеск.
  • Возможности полупостоянного наполнения.
  • Добавляет слой защиты SiO2.
  • Используется с ЦАП, поворотным или вручную.

Подготовка:
  • Вымойте, обеззаразите, нанесите смесь и подготовьте средство для полировки.

Направление:
  • Хорошо взболтать.
  • Для большего среза используйте режущий диск CARPRO из микрофибры и хорошо прогрунтуйте.
  • Для тонких и мягких красок используйте Microfiber Pad.
  • Для достижения максимального блеска экономно используйте CARPRO Gloss Pad.
  • Равномерно распределите по секции на низкой скорости.
  • Полировка на средней скорости.
  • Часто очищайте подушку.
  • Очистите подушечки и полотенца сразу после использования.

Меры предосторожности:
  • Не глотать.
  • Хранить в недоступном для детей месте.

Вопросы и ответы:

Направляющая нить CARPRO Essence Definitive Guide Thread — CARPRO Forum

1 — Что такое CARPRO Essence ?

CARPRO Essence — это полуперманентный усилитель блеска из SiO2, финишный полироль, грунтовка и покрытие в одном.

2- Должен ли я использовать ластик между Essence и CQUARTZ?

Теоретически вы можете пропустить использование Eraser, если Essence правильно использовался на машине, но это трудно измерить, если вы отполировали смазку в Essence достаточно глубоко, поэтому мы рекомендуем использовать Eraser, чтобы быть на 100% безопасным. Если возможно, подождите не менее часа после Essence, прежде чем использовать Eraser.

3 — Как долго действует CARPRO Essence?

Мы ожидаем 1 год самостоятельного использования, НО мы рекомендуем нанести Reload или CQUARTZ поверх для гораздо лучшей гидрофобности и устойчивости к загрязнениям.Это обеспечит угол контакта 115+ градусов вместо угла контакта 90 градусов (не очень хорошо) только с Essence.

4 — Итак, я могу использовать Essence с CQUARTZ?

Да, любое покрытие CQUARTZ и любой из наших нано-герметиков CARPRO, например Reload, отлично подойдут.

5 — Как это работает, если вы используете его между краской и CQUARTZ?

Он сцепляется с краской, CQUARTZ сцепляется с ним и сливается. SiO2 / смола в нем активируется нагреванием в процессе машинной полировки.При использовании вручную или при очень низких температурах перед нанесением покрытия следует стереть автомобиль.

6 — Итак, если внутри есть защита из кварца SiO2, почему вы, ребята, говорите мне, чтобы я добавил в нее Reload или CQUARTZ?

Отличный вопрос! Защита есть, как мы заявляли, НО угол контакта водяных шариков и грязеотталкивающие свойства не очень хорошие / не на уровне Reload или CQUARTZ.

7 — Легко ли использовать CARPRO Essence?

Да, обычно очень просто! Это так, но всегда есть другие переменные.Как всегда, с некоторыми красками может потребоваться небольшое обучение. Если вы наткнулись на краску, где кажется, что она немного прилипла, вам нужно изменить тип подушечки и / или скорость машины, скорость руки или давление.

  • Особенно для очень мягких красок (потому что они легче прилипают к мягкой краске) ​​рассмотрите следующий метод:
  • Используйте подушку из микрофибры.
  • Очень быстрое распространение на скорости 1.
  • Увеличьте скорость примерно до 3-4 в зависимости от машины.
  • При минимальном давлении (около фунта + вес тренажера) используйте ОЧЕНЬ медленные движения рукой по секции и сделайте только один проход.

Наконец, для некоторых красок рассмотрите возможность более быстрого движения руки с половинными укусами в разрезе, отступлением назад, а затем движением вперед, чтобы избежать прилипания продукта.

8 — Что, если я оставлю место, которое кажется прилипшим к нему Сущностью?

Просто нанесите каплю Эссенции на эту область, бегите по ней на высокой скорости руки и немедленно сотрите остатки. Его можно просто стереть замшей и каплей эссенции.

9 — Когда стирать остатки?

На некоторых красках можно оставить на час, и при этом их очень легко стереть.На мягких или пористых красках мы рекомендуем вытирать сразу после каждого участка.

10 — А как насчет моих подушечек … Нужно ли чистить их после использования, чтобы они не стали «хрустящими» от SiO2?

Да, после использования тщательно очистите подушечки APC / водой. Во время использования он не затвердевает из-за многократного насыщения пэда большим количеством эссенции.

11 — А как насчет моих салфеток из микрофибры?

Да, хорошо вымойте полотенца или замочите их после использования, если вскоре после этого вы не сможете поместить их в стиральную машину.

12 — Итак, каковы самые большие преимущества использования CARPRO Essence?

Существует МНОЖЕСТВО приложений и преимуществ, в которых Essence превосходит все, что было доступно ранее.

  • Глянец на другом уровне.
  • Сэкономленных часов на одно транспортное средство.
  • Легкость отделки даже самыми сложными красками.
  • Утолщение покрытия (Essence образует глянцевое и отражающее кварцевое покрытие), которое сцепляется с краской и сливается с CQUARTZ или Reload, если мы наносим его после Essence.
  • PPF… Все мы знаем, что это не самые красивые средства защиты… так что это была действительно крутая находка… PPF и прозрачные бюстгальтеры LOVE CARPRO Essence! Прозрачность и блеск PPF ОЧЕНЬ заметно улучшаются, когда Essence используется сверху.

13 — Сколько разреза в Essence? Насколько велик абразив?

Essence использует те же абразивы от Reflect, но в меньшем количестве. Однако из-за вязкости и баланса ряда других ингредиентов мы действительно видим неожиданное количество разрезов на некоторых красках (особенно в сочетании с режущей подушечкой из микрофибры).

14 — Это какая-то маркетинговая чушь?


15 — Могу ли я использовать CARPRO Essence без предварительного смешивания?

Это зависит от … конечно, вы можете и, безусловно, он даст отличный блеск. Что касается долговечности, это теоретически нецелесообразно. На многих красках он также будет резать намного больше, чем вы можете себе представить, в сочетании с режущим диском из микрофибры. Что касается того, насколько он будет прочным и какова ваша цель, вы должны сначала обработать его, чтобы удалить окисление и царапины.

Другими словами, если краска не в хорошем состоянии или она окислена, и вы хотите иметь долгосрочную защиту, вам СЛЕДУЕТ сначала нанести смесь.
Что касается отделки и более глубоких завитков… именно для этого и предназначены тестовые секции — при выборе, обеспечивает ли Essence желаемый разрез.

16 — А как насчет Essence, покрытого CARPRO Hydro2? Или подводная пена?

Да, в этом случае я бы посоветовал вам подождать до следующего посещения транспортных средств или в любое время по истечении 5 дней, чтобы нанести Hydro2 или промыть с помощью Hydrofoam.По моему опыту, использую Essence, а затем поддерживаю CARPRO Hydrofoam = Magic.

17 — Как скоро он намокнет?

За 1 час до выпуска в воду. НО помните, что мы наносим Reload или CQUARTZ поверх, поэтому, если CQUARTZ — это выбор для топпинга, CQUARTZ все равно потребуется время отверждения, чтобы избежать водяных пятен.

18 — Если моя машина уже в хорошем состоянии … недавняя декон, полировка, и теперь на ней есть воск, могу ли я просто использовать Essence? Или мне нужно сначала снять существующую защиту?

Я не уверен… Слишком много переменных — с воском, герметиками и правильной очисткой подушек и т.д. все будет хорошо, НО я бы не стал рисковать. Я бы хорошо удалил воск сильным мылом Iron X Snow Soap, а затем продолжил. Мы можем обновить это после того, как у нас будет достаточно полевых испытаний, чтобы доказать обратное.

19 — Каков ожидаемый срок хранения?

1 год.

20 — Следует ли снимать существующую защиту, если краска в отличной форме для нанесения Essence?

Да, я бы снял воск или герметик в качестве минимального этапа подготовки.

21 — Сколько мне следует подавать? Как полироль … или умеренно как покрытие?

Больше похоже на полироль. Паду CARPRO Gloss мы наносим экономно для большинства красок. С подушечками из микрофибры мы используем больше.

22 — Как далеко уйдет бутылка на 5 унций?

2-5 вагонов в зависимости от цели, краски, подушки и др.

23 — Можно ли использовать Essence в качестве средства для подготовки к краске на хорошо исправленном транспортном средстве, на котором уже есть CQUARTZ и / или Reload, а затем использовать CQUARTZ и / или Reload снова?

Да, вы можете использовать его, чтобы «залечить» поврежденное существующее покрытие CQUARTZ.Имейте в виду, что можно повредить часть существующей гидрофобной поверхности CQUARTZ, когда вы «залечите» любые микровыступы с помощью Essence, но если вы снова наносите покрытие поверх, это должно быть спорным вопросом. Если вы снова не наносите покрытие поверх, то вы торгуете — исправляете легкие царапины на менее гидрофобную и грязеотталкивающую поверхность.

24 — Должно ли это использоваться с CQUARTZ или Reload, или я могу использовать что-то еще в качестве LSP, или мне вообще нужно беспокоиться об использовании LSP?

Мы считаем, что вы можете использовать множество различных LSP, которые хорошо работают с этим.Мы не тестировали с ним другие продукты, поэтому результаты не являются положительными, но это наша оценка. Я бы подождал минимум час, если наносил герметик или воск с высоким содержанием растворителя. Вы можете проверить это дальше, прежде чем обойти всю машину, чтобы увидеть, достаточно ли часа. Я знаю, что один из наших друзей планирует переехать в Essence, чтобы подготовиться к высококачественному сервису Carnauba Wax. После тщательного тестирования я постараюсь не забыть обновить здесь. См. Также вопросы и ответы № 3.

25 — Подушечки какого цвета для этого рекомендуются? Я презираю колодки MF.

Краткий ответ — Scholl Concepts Spider Pad (синий или медовый).


Длинный ответ — На этот вопрос сложно ответить (опять же, так много переменных) … Он действительно будет работать с любой пенопластовой подушкой, НО в зависимости от краски вам может больше или меньше повезти с разными подушечками. Проблема заключается в том, что продукт «прилипает» к некоторым краскам (больше в определенных средах). На подушечке из микрофибры, которую нужно избегать, намного короче. Я лично тестировал подушечки Meguiar из микрофибры (как для резки, так и для отделки, глянцевые подушечки CARPRO, Orange Buff & Shine и Scholl Concepts Spider Pads (работали хорошо), а также подушечки, о которых еще не упоминалось)…

26 — Как использовать CARPRO Essence?

Пожалуйста, прочтите инструкции внизу страницы описания Essence, посмотрите видео о нашем приложении на вкладке видео и посетите наш форум www.

Вам может понравится

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *